ID: 967677357_967677360

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 967677357 967677360
Species Human (GRCh38) Human (GRCh38)
Location 3:192316442-192316464 3:192316458-192316480
Sequence CCTGTGTGTTTGGGGTAAGGAGA AAGGAGAGTACAGTGGTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 230} {0: 1, 1: 2, 2: 17, 3: 84, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!