ID: 967696732_967696733

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 967696732 967696733
Species Human (GRCh38) Human (GRCh38)
Location 3:192541629-192541651 3:192541677-192541699
Sequence CCTTCAGATGATTTTTTTTGCTC AAGAACTCCCTTACATTTCTTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 11, 3: 57, 4: 543} {0: 1, 1: 1, 2: 2, 3: 10, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!