ID: 967714374_967714377

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 967714374 967714377
Species Human (GRCh38) Human (GRCh38)
Location 3:192745430-192745452 3:192745446-192745468
Sequence CCATATACTGTGCCCTTTGTCTA TTGTCTATACAGTTGAACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 278} {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!