ID: 967723241_967723249

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 967723241 967723249
Species Human (GRCh38) Human (GRCh38)
Location 3:192837422-192837444 3:192837455-192837477
Sequence CCACCTGGGCTTCCCACCAAGCA CTCAAGGGGAGAACGAGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 324} {0: 1, 1: 0, 2: 6, 3: 6, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!