ID: 967770386_967770394

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 967770386 967770394
Species Human (GRCh38) Human (GRCh38)
Location 3:193328069-193328091 3:193328116-193328138
Sequence CCATTTCACAACTGAGTTAACAG TGAGGAGCCTAATGTCATAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 511} {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!