ID: 967822501_967822512

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 967822501 967822512
Species Human (GRCh38) Human (GRCh38)
Location 3:193851308-193851330 3:193851328-193851350
Sequence CCCCAAGGCCCCCCCAAAAGCCT CCTTTTATCCTGGAGCTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 332} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!