ID: 967826494_967826496

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 967826494 967826496
Species Human (GRCh38) Human (GRCh38)
Location 3:193881718-193881740 3:193881732-193881754
Sequence CCACCTTCTGTGTAGACCCCTCC GACCCCTCCTCACCCCACTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 34, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!