ID: 967846795_967846797

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 967846795 967846797
Species Human (GRCh38) Human (GRCh38)
Location 3:194050309-194050331 3:194050325-194050347
Sequence CCAGTCTTGATAGAATTACTACT TACTACTGTTCTCAGACATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 162} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!