ID: 967891180_967891186

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 967891180 967891186
Species Human (GRCh38) Human (GRCh38)
Location 3:194365671-194365693 3:194365692-194365714
Sequence CCTCATCTTCTCTTCCCCAGAGG GGACCTGCTGGACCTCCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 442} {0: 1, 1: 0, 2: 1, 3: 26, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!