ID: 967891922_967891931

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 967891922 967891931
Species Human (GRCh38) Human (GRCh38)
Location 3:194369750-194369772 3:194369788-194369810
Sequence CCTAAGCTGTCCCGGTATTTAAA GTCACTGCAGAGGGCAGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 50} {0: 1, 1: 0, 2: 2, 3: 44, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!