ID: 967899967_967899980

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 967899967 967899980
Species Human (GRCh38) Human (GRCh38)
Location 3:194440033-194440055 3:194440054-194440076
Sequence CCTCCCTCTCTCCCTTTCAAAAT ATGTGGGTAGGGAGGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 85, 4: 910} {0: 1, 1: 3, 2: 98, 3: 620, 4: 13148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!