ID: 967902273_967902277

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 967902273 967902277
Species Human (GRCh38) Human (GRCh38)
Location 3:194466856-194466878 3:194466897-194466919
Sequence CCACCCATCTGAAGCTTTTAGAC GACATTTATTTCTGGCACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117} {0: 1, 1: 0, 2: 0, 3: 21, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!