ID: 967904136_967904151

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 967904136 967904151
Species Human (GRCh38) Human (GRCh38)
Location 3:194486900-194486922 3:194486937-194486959
Sequence CCGCCAGCGACGTAGAGAACCCC CGGCGCCCGATCACGCTGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 31} {0: 1, 1: 0, 2: 0, 3: 2, 4: 18}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!