ID: 967916772_967916777

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 967916772 967916777
Species Human (GRCh38) Human (GRCh38)
Location 3:194584146-194584168 3:194584169-194584191
Sequence CCCCTCTGGCACGATCGTGGATG AACCCCCTGGCAACTGAAATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!