ID: 967917644_967917647

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 967917644 967917647
Species Human (GRCh38) Human (GRCh38)
Location 3:194590657-194590679 3:194590675-194590697
Sequence CCAGAAGCACCCAGGCTGCTGGC CTGGCTAAAAACACTGATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 27, 4: 257} {0: 1, 1: 0, 2: 0, 3: 29, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!