ID: 967943045_967943048

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 967943045 967943048
Species Human (GRCh38) Human (GRCh38)
Location 3:194780908-194780930 3:194780933-194780955
Sequence CCAGCCACAAGCTGACTTGAGTC AAAGTCACAAAGTGTGACTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 116} {0: 1, 1: 0, 2: 2, 3: 18, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!