ID: 967973142_967973150

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 967973142 967973150
Species Human (GRCh38) Human (GRCh38)
Location 3:195013939-195013961 3:195013963-195013985
Sequence CCTTGCCAAATGGAGCCTCCTAA GCCTCAGCATCTTTAGGAGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 262, 4: 8863}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!