ID: 967982391_967982406

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 967982391 967982406
Species Human (GRCh38) Human (GRCh38)
Location 3:195073478-195073500 3:195073529-195073551
Sequence CCCTCCCCCCCTCATGCCCACAA TTGTCTAACCGTCCGGCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 578} {0: 1, 1: 0, 2: 0, 3: 1, 4: 18}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!