ID: 967986073_967986078

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 967986073 967986078
Species Human (GRCh38) Human (GRCh38)
Location 3:195096154-195096176 3:195096200-195096222
Sequence CCCTTTGACCTTAAGCAGAAAAG TAGAGTACCTGCTAAGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 184} {0: 1, 1: 1, 2: 0, 3: 3, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!