ID: 968001031_968001038

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 968001031 968001038
Species Human (GRCh38) Human (GRCh38)
Location 3:195206944-195206966 3:195206974-195206996
Sequence CCTCTCTCCTTCTGTGGATATTT TCCATAATAAAAGGTGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 410} {0: 1, 1: 0, 2: 1, 3: 38, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!