ID: 968003016_968003023

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 968003016 968003023
Species Human (GRCh38) Human (GRCh38)
Location 3:195220596-195220618 3:195220623-195220645
Sequence CCCCCTTTCAGCCTGCTCAGACC TGCCTCAGTGCTCCCTACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 247} {0: 1, 1: 0, 2: 0, 3: 13, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!