ID: 968010497_968010505

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 968010497 968010505
Species Human (GRCh38) Human (GRCh38)
Location 3:195271105-195271127 3:195271130-195271152
Sequence CCTCGGGTACCCGGACGCCGGCG CACTTAGCCCCGGCGCCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 67} {0: 1, 1: 0, 2: 0, 3: 9, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!