ID: 968038263_968038273

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 968038263 968038273
Species Human (GRCh38) Human (GRCh38)
Location 3:195567059-195567081 3:195567093-195567115
Sequence CCTCCATGCCCACCTCCTCCTCA CTAACGGCTTTCAGCCTTTTGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 19, 3: 202, 4: 1501} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!