ID: 968041412_968041419

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 968041412 968041419
Species Human (GRCh38) Human (GRCh38)
Location 3:195592223-195592245 3:195592257-195592279
Sequence CCTGAGATGTCTTGGAAGCCATG GAGAGAAAGGAGAAGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 165} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!