ID: 968046147_968046163

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 968046147 968046163
Species Human (GRCh38) Human (GRCh38)
Location 3:195624813-195624835 3:195624866-195624888
Sequence CCAGGGGGCGCTGCCGGCCCGAG AGGAGCCGCTGTGCGCGTTCAGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 2, 3: 35, 4: 266} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!