ID: 968060254_968060263

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 968060254 968060263
Species Human (GRCh38) Human (GRCh38)
Location 3:195722347-195722369 3:195722392-195722414
Sequence CCGTGGCCTGGTCTGCGCTGCAC CAGGTGCGGAAATGCAGGCTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 19, 4: 207} {0: 2, 1: 0, 2: 2, 3: 41, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!