ID: 968061518_968061530

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 968061518 968061530
Species Human (GRCh38) Human (GRCh38)
Location 3:195729691-195729713 3:195729737-195729759
Sequence CCCGGAAGACCTCACTGACCCCA CAGGTGAGTGGGCACTTTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 65, 4: 427} {0: 1, 1: 1, 2: 0, 3: 26, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!