ID: 968065911_968065918

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 968065911 968065918
Species Human (GRCh38) Human (GRCh38)
Location 3:195759358-195759380 3:195759405-195759427
Sequence CCAGGACTGTGACCCACCTCTGG GCTCTCGACTGACGCACAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 244} {0: 1, 1: 0, 2: 0, 3: 8, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!