ID: 968065916_968065918

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 968065916 968065918
Species Human (GRCh38) Human (GRCh38)
Location 3:195759374-195759396 3:195759405-195759427
Sequence CCTCTGGAAGAAGGAATTATTCT GCTCTCGACTGACGCACAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 303} {0: 1, 1: 0, 2: 0, 3: 8, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!