ID: 968066195_968066205

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 968066195 968066205
Species Human (GRCh38) Human (GRCh38)
Location 3:195761160-195761182 3:195761191-195761213
Sequence CCTTATTCCATCTGTGTCCACCT CACTTTAGATGGCTTGGAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 250} {0: 1, 1: 0, 2: 1, 3: 9, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!