ID: 968075884_968075891

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 968075884 968075891
Species Human (GRCh38) Human (GRCh38)
Location 3:195815992-195816014 3:195816018-195816040
Sequence CCGGCCTCCTTCTCCCTACGCAG CCACATCCTCCTGCCCAGCCCGG
Strand - +
Off-target summary No data {0: 22, 1: 12, 2: 10, 3: 80, 4: 849}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!