ID: 968075921_968075927

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 968075921 968075927
Species Human (GRCh38) Human (GRCh38)
Location 3:195816127-195816149 3:195816153-195816175
Sequence CCGGCCTCCTTCTCCTTACGCAG CCACATCCTCCTGCCCAGCCCGG
Strand - +
Off-target summary No data {0: 22, 1: 12, 2: 10, 3: 80, 4: 849}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!