ID: 968076144_968076148

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 968076144 968076148
Species Human (GRCh38) Human (GRCh38)
Location 3:195816953-195816975 3:195816974-195816996
Sequence CCGGCCTCCTTCTCCTTACACAG AGATGCCACATCCTCCTGCCCGG
Strand - +
Off-target summary {0: 2, 1: 15, 2: 7, 3: 54, 4: 557} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!