ID: 968082102_968082110

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 968082102 968082110
Species Human (GRCh38) Human (GRCh38)
Location 3:195853782-195853804 3:195853825-195853847
Sequence CCAAATAGAAAATTCGCCTGAGA CACAGGCCATGGACCTCCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 115} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!