ID: 968085125_968085127

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 968085125 968085127
Species Human (GRCh38) Human (GRCh38)
Location 3:195870731-195870753 3:195870747-195870769
Sequence CCTGGAGGAATGGGGCTGGGCTG TGGGCTGGCCACAGCATGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 63, 4: 528} {0: 1, 1: 1, 2: 3, 3: 27, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!