ID: 968087364_968087369

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 968087364 968087369
Species Human (GRCh38) Human (GRCh38)
Location 3:195879865-195879887 3:195879904-195879926
Sequence CCCGCCCACTTCATCGTGCTGTT CATACCTTACCATGCAAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 111} {0: 1, 1: 0, 2: 3, 3: 3, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!