ID: 968099197_968099209

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 968099197 968099209
Species Human (GRCh38) Human (GRCh38)
Location 3:195954066-195954088 3:195954089-195954111
Sequence CCCCAGGAGACCGGGCAGCGGAC GGGGGAGACCGCGGGGGACCCGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 0, 3: 8, 4: 124} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!