ID: 968124309_968124321

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 968124309 968124321
Species Human (GRCh38) Human (GRCh38)
Location 3:196147135-196147157 3:196147187-196147209
Sequence CCTGCGCCCCAGTGGGGTTCAGA TATGGGAGGCAGGAAAAGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 56, 4: 620}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!