ID: 968137010_968137013

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 968137010 968137013
Species Human (GRCh38) Human (GRCh38)
Location 3:196227053-196227075 3:196227067-196227089
Sequence CCTGTACAAGAACACCCTTTGCC CCCTTTGCCCCATCAAGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 142} {0: 1, 1: 0, 2: 7, 3: 27, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!