ID: 968149781_968149783

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 968149781 968149783
Species Human (GRCh38) Human (GRCh38)
Location 3:196327986-196328008 3:196328004-196328026
Sequence CCACACAGATAGGAAAGAAAGAA AAGAAGTAATATTGTCGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 92, 4: 841} {0: 1, 1: 0, 2: 3, 3: 39, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!