|
Left Crispr |
Right Crispr |
| Crispr ID |
968160743 |
968160748 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:196424627-196424649
|
3:196424642-196424664
|
| Sequence |
CCTTCCACCTTGGCATTCCAAAG |
TTCCAAAGTGCTGGGATTACCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 77, 2: 2660, 3: 30607, 4: 87324} |
{0: 9594, 1: 299194, 2: 262940, 3: 149017, 4: 131705} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|