ID: 968190041_968190049

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 968190041 968190049
Species Human (GRCh38) Human (GRCh38)
Location 3:196660879-196660901 3:196660899-196660921
Sequence CCAGCTCCTGGGCGTCCCCCCTG CTGGCCTCTTCGCCAATGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 335} {0: 1, 1: 0, 2: 1, 3: 10, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!