ID: 968199559_968199562

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 968199559 968199562
Species Human (GRCh38) Human (GRCh38)
Location 3:196740264-196740286 3:196740278-196740300
Sequence CCCGCGCGGGGCCGGGGAGCCGC GGGAGCCGCCACCTGCGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 367} {0: 1, 1: 0, 2: 2, 3: 11, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!