ID: 968199559_968199567

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 968199559 968199567
Species Human (GRCh38) Human (GRCh38)
Location 3:196740264-196740286 3:196740294-196740316
Sequence CCCGCGCGGGGCCGGGGAGCCGC GTGCTGGGAGCCGCAGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 367} {0: 1, 1: 1, 2: 7, 3: 82, 4: 494}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!