ID: 968213508_968213517

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 968213508 968213517
Species Human (GRCh38) Human (GRCh38)
Location 3:196868452-196868474 3:196868487-196868509
Sequence CCTTCCGGCCTTCGTTTCTTTCC GGACCCTTTTCCAGAGAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 256, 4: 3469} {0: 1, 1: 0, 2: 2, 3: 23, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!