ID: 968224696_968224705

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 968224696 968224705
Species Human (GRCh38) Human (GRCh38)
Location 3:196966526-196966548 3:196966544-196966566
Sequence CCCTTTGAGATTCATCTCCAGCC CAGCCTGGGTGGGCCCACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 185} {0: 1, 1: 0, 2: 1, 3: 30, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!