ID: 968229406_968229419

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 968229406 968229419
Species Human (GRCh38) Human (GRCh38)
Location 3:196996504-196996526 3:196996536-196996558
Sequence CCTGCCCCATCCCTGAAACCCTC CCATCTCGGGAACTTTCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 65, 4: 553} {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!