ID: 968230799_968230818

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 968230799 968230818
Species Human (GRCh38) Human (GRCh38)
Location 3:197003479-197003501 3:197003513-197003535
Sequence CCGAAGCCCGGGCCGCGGTGGCC CCGCTCTGGGGTGGGGGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 178} {0: 1, 1: 1, 2: 21, 3: 276, 4: 2291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!