ID: 968241632_968241639

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 968241632 968241639
Species Human (GRCh38) Human (GRCh38)
Location 3:197093843-197093865 3:197093875-197093897
Sequence CCTTGCAATTTCCCCATCGACAG AATTCCCCTCTCCTGGAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 104} {0: 1, 1: 2, 2: 12, 3: 95, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!