ID: 968257653_968257654

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 968257653 968257654
Species Human (GRCh38) Human (GRCh38)
Location 3:197292002-197292024 3:197292024-197292046
Sequence CCTGTGTGCTGCTGGTGAGACTG GTAAAATGCTGCAATCACTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 40, 4: 291} {0: 1, 1: 2, 2: 45, 3: 418, 4: 2076}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!